                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-27.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTGCCCACCCTGCTGGGCGAAGGAGGCAAGAAGATCGCCCAGTTCATGGTTGACGA
GTACGCCAAGCTCGCGAAGTAAgggctgaagcgaggcaatcgcacggcgtaatacagctggcttccctctcctgaggggggcca
gctttgtttaggctcaacagttgtttggagacactacaacacgccgattgttgtatgtgcaactgttgtatatgggtctctttatcatgaattgttgcgt
atacaacaatgtggggtgaaggtacaaacgcacacggccccgcatggtacggaggacaATG

    BL1765 --- BL1766 --- BL1767 Gene: BL1765     GI: 23466309     BI number: BL1765     GOG: COG1846     Description: possible MarR-type transcriptional regulator Gene: BL1766     GI: 23466310     BI number: BL1766     GOG: COG1132     Description: ATP-binding protein of ABC transporter Gene: BL1767     GI: 23466311     BI number: BL1767     GOG: COG1132     Description: ABC transporter, ATP-binding transmembrane protei at a  a t  c g  a cg        cc gc       t  t gt        cg cg        ta a  |       cg cg        cg gc        cg c  t       tg t  t       tg a  c       cg a  |       gc c  |       gc gc        ta gc        cg at        gc gc        at             ttgtttaggctcaacagttgtttggagacactacaacacgccgattgttgtatgtgcaactgttgtatatgggtctctttatcatgaattgttgcgtatacaacaatgtggggtgaaggtacaaacgcacacggccccgcatggtacggaggacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here     ..................................................................................................................