                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-38.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAGGTCGAGCAGTTCCGAGACCTGATTGCCCACGAGACGCTGGCTACCTCCTTCG
AGGTGAAGGAGGGCGCCGAGCTGGGCGTGGAGGTTGTTAAGGCGTGAggctgatgctgagctaag
gctcttcaattggtctgaaacaattgcgggcatccgatatacagtgattcaatgaacactgcatatcggatgcccgcatttttcgcgcgtttatgcgtct
tttcgacgcatccctattttgaaaaaaactaacttattcaagtttttcaaaatagaaggggaacggttctacctctcATG

    BL1778 Gene: BL1778     GI: 23466322     BI number: BL1778     GOG: NOG42513     Description: truncated type I restriction system specificity protei   a a  t cg ta ta a  | gc ta         t gc       t  t at       a  t cg       c  t a  c       gc ta        cg at       c  c ta        cg at        gc gc        tg cg        at cg        gt         t ta       g  |      t  t at       c  |      t  c cg       t  |       cg gc        at        ta gc        ta        gc gc        at        cg cg        cg        gc gc        gc        ta ta        tg        at                         ccctattttgaaaaaaactaacttattcaagtttttcaaaatagaaggggaacggttctacctctcATG     ..................................................................................................................