Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-14.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgaatccggacatgcgtgtaagttattcacctgttgccgctcagcgcggcgggttccttcctctggttggtttcccgtctggctggtgtggtggtggttt
gagaactcaagagcgtgtttgtactacttctttatagtcaatgattgccagttcattcctcgcctgattgcctgtcgtggtggttgggtacccgggaggg
tttgatgaggggtgaggttttttgagggcgtccttccttaaggacgtgctcgtcaatttttgttttgagagtcatctattcggatgcttttcatgaagtt
TTT

    _v10 --- _v11 --- _v12


Gene: _v10     GI: BLr02     BI number: BLr02     GOG: -------     Description: 16S ribosomal RNA
Gene: _v11     GI: BLr08     BI number: BLr08     GOG: -------     Description: 23S ribosomal RNA
Gene: _v12     GI: BLr09     BI number: BLr09     GOG: -------     Description: 23S ribosomal RN


 gg
g  a
 cg
 cg
 cg
 at
t  t
g  t
g  g
g  |
t  |
t  |        t
g  |      t  g
g  |      t  a       ct
t  |       tg       c  t
g  |       tg        ta
g  |       tg        ta
 ta        gc        cg
 gt       g  g       cg
 cg        at        ta
 ta        gc        gc
g  g      t  c       cg
 tg        gt        gt
 cg        gt       g  g
 cg        gc        gc
 gt        gc        at
 tg        at        gc
 ta        gt        tg
                        tcaatttttgttttgagagtcatctattcggatgcttttcatgaagttTTT


    ..................................................................................................................