                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-14.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttgcgcgagtccgcgaatgcgtgtaagttatttccttgctgccgctcagcgagtggttctcctccggggagctgcgaggtgggtgagtggtggtggttt
gagaactcaagagcgtgtttgtactacttctttatagtcaatgattgccagttcattcctcgcctgattgcctgtcgtggtggttgggtacccgggaggg
tttgatgaggggtgaggttttttgagggcgtccttccttaaggacgtgctcgtcaatttttgttttgagagtcatctattcggatgcttttcatgaagtt
TTT

    BLr03 --- _v2 --- _v3 --- _v4 --- _v5 --- _v6 Gene: BLr03     GI: BLr03     BI number: BLr03     GOG: -------     Description: 16S ribosomal RNA Gene: _v2     GI: BLr06     BI number: BLr06     GOG: -------     Description: 23S ribosomal RNA Gene: _v3     GI: BLr12     BI number: BLr12     GOG: -------     Description: 23S ribosomal RNA Gene: _v4     GI: BLr04     BI number: BLr04     GOG: -------     Description: 16S ribosomal RNA Gene: _v5     GI: BLr05     BI number: BLr05     GOG: -------     Description: 23S ribosomal RNA Gene: _v6     GI: BLr11     BI number: BLr11     GOG: -------     Description: 23S ribosomal RN gg g  a cg cg cg at t  t g  t g  g g  | t  | t  |        t g  |      t  g g  |      t  a       ct t  |       tg       c  t g  |       tg        ta g  |       tg        ta ta        gc        cg gt       g  g       cg cg        at        ta ta        gc        gc g  g      t  c       cg tg        gt        gt cg        gt       g  g cg        gc        gc gt        gc        at tg        at        gc ta        gt        tg                         tcaatttttgttttgagagtcatctattcggatgcttttcatgaagttTTT     ..................................................................................................................