                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:157 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=28 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=55 nt.     Delta G= -6.59 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAA-TAAGAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAAACCGGTATCTCTTAGCTTAAGATTATTTGGAAATATGTATTCTGGAGAGTTA
ATTTTTATATTAATTGCTGGATTTTTGCCGTGGTGGAGTCAGTGGATGTTGAGTGTAC
CATGGGCTATTTTTCATATTTTAATTATTATATTACAGGCTTTTATTTTTATGGTATT
GACAATTATTTATTTATCTGAATCTCATTATGAGTATAAGCCATAAtttatgagtgttattaaata
agttatgggtgtattaataataaatggttattgatggggtatattattATG

    atpE Gene: atpE     GI: 33519486     BI number: Bfl003     GOG: COG0636     Description: ATP synthase subunit TT T  A T  T TA AT AT TA TA GT AT G  G A  | GC                  GA GT                 G  T TG                 T  G CG        GT        GT TA       C  G       AT T  T       CG        CG A  T       GT        TA T  T       TG       G  G G  T       TG       A  T T  T       TA       G  G A  G      T  G       GT T  |      T  |       TA A  |      A  |       GC A  |       GT        GC A  |       GC        TA GC        TA        GT GC        CG        CG TG        GT        CG                         GCTATTTTTCATATTTTAATTATTATATTACAGGCTTTTATTTTTATGGTATTGACAATTATTTATTTATCTGAATCTCATTATGAGTATAAGCCATAAtttatgagtgttattaaataagttatgggtgtattaataataaatggttattgatggggtatattattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0636 F0F1-type ATP synthase, subunit c/Archaeal/vacuolar-type H+-ATPase, subunit K ... can be seen here     ..................................................................................................................