                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=35 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttttt-tagaat. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttttttttgttaattttatgttagaatagtaagaattactgctgataatgtagatttgataatatttatgttactcaatgtgaatgaaaatgatatcg
cattgggttttttattttactgtaaaattggttgttgttaataagtataaattttaattatggtcgataattaaaattataatatatttatgtattaatt
ataagaatatgatttccaggtcctggtattacttaatgaaaatattgattttttttgagggggtactATG

    gltP Gene: gltP     GI: 33519513     BI number: Bfl030     GOG: COG1301     Description: proton glutamate symport protei at a  t g  a a  c at tg gc at                  aa tg        at       g  a a  a      g  a       ta a  |      t  a       at g  |      t  t      |  g at        ta       |  a ta        at       |  t ta        gt       |  a gt        at        at tg        ta        gc at        gt        tg ta        tg        gc tg        at        ta ta        at        at t  t       ta        at at       |  c       cg at        at        tg tg        gc        cg ta        ta        at                         tttttattttactgtaaaattggttgttgttaataagtataaattttaattatggtcgataattaaaattataatatatttatgtattaattataagaatatgatttccaggtcctggtattacttaatgaaaatattgattttttttgagggggtactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1301 Na+/H+-dicarboxylate symporters ... can be seen here     ..................................................................................................................