                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.70 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=37 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=45 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TATAAT. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAAAAAAAGTAGTGTTTTGCGCTATAATAATTTGATAGAGAGTTTAGCATTACGT
CATTAAatattttataaaagtaaatagaatgatgtgttttttaaaaaaatcatgttgtatttgcataaatatacgacatagtgataattgtgttga
taatttttatgtaaagtttagtatagttattttatagatttcattaaaagtgttatataataaaggatattattTTG

    truB Gene: pnp     GI: 33519583     BI number: Bfl108     GOG: COG1185     Description: polynucleotide phosphorylase, member of mRNA degradosom   a t  a ta ta ta        at ta       c  a ta       g  a gt       t  a t  |      t  t gc        ta        at ta        at       g  a at        ta        ta g  |       gc        gt tg        tg        at at        ta        tg at        gc        at g  g       ta        cg at       |  t       at ta       |  a       gt at       |  g       cg at        at       a  | at        cg        ta tg        ta        at gc        at        ta                         atttttatgtaaagtttagtatagttattttatagatttcattaaaagtgttatataataaaggatattattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1185 Polyribonucleotide nucleotidyltransferase (polynucleotide phosphorylase) ... can be seen here     ..................................................................................................................