                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-32.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTAAACCAGTTAAAAAACAAGCTGAAAAAGAAGGATTAGATTCAATATTTATAAAAG
CCGGTTTTGAATGGCGTTTACCTGGTTGTTCCATGTGTTTAGGTATGAACGAAGATCG
ATTAAACGCAGGAGAACGTTGCGCTTCTACAAGTAATCGAAACTTTGAAGGACGACAA
GGTCGAGGAGGACTTACTCATTTAGTCAGTCCAGCAATGGCAGCAGCTGCTGCCATTG
CTGGACATTTTGTCGACATTCGAACATATTTTTAAtttaattacatatataacagagaatatatcaacATG

    leuD Gene: leuD     GI: 33519604     BI number: Bfl130     GOG: COG0066     Description: 3-isopropylmalate dehydratase subunit GA G  C A  G A  A        T GC       A  T TA       C  T TA        TA        GC TG        CG       A  T CG        AT        CG A  |      T  C       GC A  |       TA        AT AT        CG        CG GC        AT        GC CG        GC        GC TA        GC        TA |  G      |  A       AT |  G      A  G       AT |  A      G  C       CG A  G      G  A       GC A  G      A  A       AT TA        GT        CG GC        CG        CG AT        TG        TA AT        GC        GC                         ATTTTGTCGACATTCGAACATATTTTTAAtttaattacatatataacagagaatatatcaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0066 3-isopropylmalate dehydratase small subunit ... can be seen here     ..................................................................................................................