                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=36 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:    Distance from promoter:21 nt.    Size=39 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATT-TAAAGT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATTCAATTCTGAAATATGCTAAAGTTCAGCCTATATTTGTGCAAAATGAATGTTT
TTTATTGAAATTTTTGATGAATTTGCTTCGAGATAAGGATTTGCTCTTAATTCAGGGA
GCTGGAACAATTAGTGAGATTGTGAAGGCTTTATTTATAAAAAGATGAtaaagttaatatatta
tggtaataataaaatttgaatattgaatcaatagaatttttaactatttataataagtgtgatgttaATG

    ftsQ --- ftsA Gene: ftsQ     GI: 33519618     BI number: Bfl144     GOG: COG1589     Description: cell division protein FtsQ Gene: ftsA     GI: 33519619     BI number: Bfl145     GOG: COG0849     Description: cell division protein Fts   T A  T AT        TT AT       T  G G  T      A  C T  G       GT         T TA        GC       G  G AT        AT       A  A TG        AT        TG TA        TA        TA TA       A  A       AT |  T       GT        AT T  T       AT        CG T  T       GC        AT TG       |  A      A  G GC       |  G      G  A T  |       CG       G  A AT        TG        TG AT        TA        CG GC        CG        GC TG        GC        AT                         TTATTTATAAAAAGATGAtaaagttaatatattatggtaataataaaatttgaatattgaatcaatagaatttttaactatttataataagtgtgatgttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1589 Cell division septal protein ... can be seen here [D] COG0849 Actin-like ATPase involved in cell division ... can be seen here     ..................................................................................................................