                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:161 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=47 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=43 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGATT-TATAGT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATTGTTGTTTCTATAAATCGTATAGTGAAGCATTCAATGTATAAAAAATTTATTA
ATCGTACTACTAAGATATATGTACATGATACTAATAATATTAGTAATGTGGGTGATAT
AGTAGAGATAACAGAATGTCGTCCTATTTCTAAAACTAAATGTTGGAAGTTAACTTCG
ATTATAAAAAAATATAATTCTTCTTAAtaagaagaatttatttatataaatttagaatagttaatgtttaagtatttttt
atgtgaatagttttttgtttgaggtgttatGTG

    rpsC Gene: rplN     GI: 33519668     BI number: Bfl201     GOG: COG0093     Description: 50S ribosomal subunit protein L1            AA           A  A           A  A            AT            TA   A        AT T  A       TA C  A       TA A  T       AT A  G       GT AT       C  | AT       T  | TG       T  | CG       C  | TA       A  | TA       A  | TG       T  | AT       T  |        A |  T       GC       A  t |  A       AT        Ta T  A       AT        Ta C  C       GC        Cg C  T      |  T       Ta T  T       GT        Ta GC        TA        Cg CG        TA        Ta TA        Gt        Ta GT        Ta        At                         ttatttatataaatttagaatagttaatgtttaagtattttttatgtgaatagttttttgtttgaggtgttatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0093 Ribosomal protein L14 ... can be seen here     ..................................................................................................................