                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:47 nt.    Distance to gene:135 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G=-13.30 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=28 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=35 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAGG-TAAAAT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAGGAAAGGTGGAATGCTGTGTTAAAATTACAAACTTTACCTAGAGATTCTAGTCC
GTCTAGATTACGTAATCGTTGTGGACGAACAGGTCGTCCACATGCTTTTTTAAGAAAA
TTTGGATTAAGTCGAATGAAGGTTAGAGAGGCTGCTATGAAGGGTGAAATTCCTGGAT
TAAGAAAATCTAGTTGGTAAtgaaaatatgaatgcaataatcactgtttattatatagagtaattataattATG

    rplN Gene: rpsH     GI: 33519672     BI number: Bfl205     GOG: COG0096     Description: 30S ribosomal subunit protein S   C C  G T  T GC AT TA        AA CG       T  T TA        GC T  |       CG         A A  |       AT       C  G G  |      T  T      A  G A  |      T  G       AT GT       A  |       GC AT       G  |       CG TA        AT        AT C  C       TG        GC CG        CG        GC AT        TA        TA TA        GC        GC TA        CG        TA                         TGCTTTTTTAAGAAAATTTGGATTAAGTCGAATGAAGGTTAGAGAGGCTGCTATGAAGGGTGAAATTCCTGGATTAAGAAAATCTAGTTGGTAAtgaaaatatgaatgcaataatcactgtttattatatagagtaattataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0096 Ribosomal protein S8 ... can be seen here     ..................................................................................................................