                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:79 nt.    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:74 nt. Size=20 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=54 nt.     Delta G= -6.77 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-taaaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaatcagaaattgaatataaatataaaattttaagttaattgtacataaccgttattaaaaataatagtttataagtaaaatttataatgcctgtaat
ggtattgatattattgttaatattatattaacaataattatttgaaatcttataaactaatttttatatacatatataaacatcataatcatattagtta
gattgatttttctttatactcaatttaataatgcatgtttgattaaatatatattatgggaattaaaatctaatATG

    ybeB Gene: ybeB     GI: 33519773     BI number: Bfl310     GOG: COG0799     Description: conserved hypothetical protei ta g  a t  t cg cg gt ta at at tg a  a t  t t  | t  | a  | a  | a  | a  | t  | g  | a  |                  t a  |                t  a t  |                 at a  |                 ta t  |       tg        at t  |      t  t       at ta        at        ta gt        ta        ta at        ta        gc ta        at        ta at        ta        ta at        at        at tg        gt        ta at        ta        ta                         ttatttgaaatcttataaactaatttttatatacatatataaacatcataatcatattagttagattgatttttctttatactcaatttaataatgcatgtttgattaaatatatattatgggaattaaaatctaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here     ..................................................................................................................