                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=75 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:    Distance from promoter:15 nt.    Size=33 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgtaa-tatatt. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgtaattattattaaataattttatatttattgttaaaataaaatatataatttatagtatatataaactatatgtataatttttaatttatgatattg
gttaacgatgacaataaataattacaatatatattataaatatatattgtaattatttatttggtgttatgttaattatgtagttgttacatatcaaatt
gtagtcattgttactaatataatataattgataaaaataaatcttggggtattatattATG

    rpmF Gene: rpmF     GI: 33519867     BI number: Bfl408     GOG: COG0333     Description: 50S ribosomal protein L3             t           t  a           g  a            gc            tg            ta            at            tg           |  a           a  c           g  a            ta            at            ta            ta            ta            at           a  |           t  |           t  |           t  |            ta            ta         t            at       a  a            at        ta   a        ta        ta t  t      |  c       at g  a      a  a       ta at        ta        at ta        gt        ta at        ta        at ta        at        ta ta        ta        at ta        at        at a  c       ta        cg at       c  |       at ta       a  |       ta at        at        ta ta        at        at at        ta        at tg        at        ta at        ta        at                         ttatttggtgttatgttaattatgtagttgttacatatcaaattgtagtcattgttactaatataatataattgataaaaataaatcttggggtattatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0333 Ribosomal protein L32 ... can be seen here     ..................................................................................................................