                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-15.90 kcal/mol
Antiterminator:    Distance from promoter:110 nt. Size=68 nt.     Delta G= -4.97 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CGGTAA-TACAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTAATTATTTGAAAAAATGTGTTACAATCAGCAGCAGTTATTTATTAAGTAAACAG
TTATCTGCCACTGTTGATTATCGGATAAACTTATTGCATAAAACTGATTTTACTACAG
TTGCTCAGATTAATACTGATAATATGATTGCGTTAGGTGTATCTTATTTATTTTAAta
atagtattaatgttatacaaaaaaaagaaaatcgaattattttataattcgattttctttttttatagggtaataatatagttacagtaatatagaatga
aaaataatatctATG

    ddlA Gene: ddlA     GI: 33519925     BI number: Bfl474     GOG: COG1181     Description: D-alanine:D-alanine ligase At A  a T  a T  t Ta Tg At Ta |  t |  t Ta Ta At Tg T  t C  t Ta At         t Ta       t  t Gc        ta Ta        at |  a       ta |  a       ta G  a       at G  a       at A  a       gc T  a       cg T  a       ta G  g       at C  a       at G  a       at Ta        at Ta        gc At        at Gc        at Tg        at             ttttatagggtaataatatagttacagtaatatagaatgaaaaataatatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_floridanus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:174 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.90 kcal/mol Antiterminator:    Distance from promoter:138 nt. Size=68 nt.     Delta G= -4.97 kcal/mol Anti-antiterminator:    Distance from promoter:110 nt.    Size=53 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: CGGTAA-TACAAT. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGTAATTATTTGAAAAAATGTGTTACAATCAGCAGCAGTTATTTATTAAGTAAACAG TTATCTGCCACTGTTGATTATCGGATAAACTTATTGCATAAAACTGATTTTACTACAG TTGCTCAGATTAATACTGATAATATGATTGCGTTAGGTGTATCTTATTTATTTTAAta atagtattaatgttatacaaaaaaaagaaaatcgaattattttataattcgattttctttttttatagggtaataatatagttacagtaatatagaatga aaaataatatctATG     ddlA Gene: ddlA     GI: 33519925     BI number: Bfl474     GOG: COG1181     Description: D-alanine:D-alanine ligase            ag           a  a           a  a           a  a            aa            at            ac            ag TT       |  a A  T      |  a T  T       ct TA        at TA        ta At        at Ta       t  t Ta       t  t C  t       gt T  a       ta A  g       a T  t       a G  a       t T  |      | G  |      | Gt       t At       a          t Ta       t        t  t Ta       g         ta Gt       a         at Cg       t         ta Gt       a         ta T  t      a         at Ta        t        at At        A        gc |  a       A        cg Gc        T        ta Ta        T        at                         tttctttttttatagggtaataatatagttacagtaatatagaatgaaaaataatatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................