                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.00 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=36 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagatt-tataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagattatgataattcataacaatataataattttctaatactaatactaatataatgttctttgtagcatggaatttaaataaatagaagtatatttaa
aaaatttttgatgttttatggattattatatgttttaaagtaatgaatgttattctataacataaatttatgtgttatggttttttaatgaatattaaaa
attATG

    tRNA Gene: lig     GI: 33519955     BI number: Bfl507     GOG: COG0272     Description: DNA ligas aa g  t tg at at ta        tt gt       a  t at       a  a a  c       at at        tg ta        at t  t       cg ta        at ta        at gc        ta ta        at at        tg ta        cg             ttttttaatgaatattaaaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................