Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.60 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=75 nt.     Delta G= -4.43 kcal/mol
Anti-antiterminator:    Distance from promoter:77 nt.    Size=44 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAATT-TATTGT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAATTTTAAGACAACAATTTGATATTGTTATTCAAGCAGTGATAGGAAAGCGAGTAA
TATGTCGGGACGTTATAAAACAATTAAGAAAAAATGTTACGCATAAATGTTATGGGGG
AGATGTTACTAGAAAGAAAAAATTATTGCATAACCAGAAAATAGGAAAAAAGCGAATG
AAACAAGTAGGTAAGGTTAATTTACCTAATAGTGTTTTTATGTCTATTTTGAATAGAG
ATAGTTAAtgtatacccacatttaattgttattgtaaaggttaatattagtATG

    lepB


Gene: lepB     GI: 33519988     BI number: Bfl541     GOG: COG0681     Description: signal peptidase


           AA
          A  A
          G  T
          A  A
           CG
           CG
          |  A
          |  A
          A  A
          A  A
          T  A
          A  A
           CG
           GC
           TG
           TA
          A  A
          T  T
 GA       T  G
A  A      A  A
 TA       A  A
 CG       A  A
A  A      A  C        T
 TA       A  A      T  A
 TA       A  A      G  A
G  A      G  G       GT
T  A      A  T       AT
A  A      A  A       AT
G  T      A  |       TA
A  T      G  |       GC
G  A      A  |       GC
 GT        TG        AT
 GT        CG        TA
G  G       AT       |  A
 GC        TA       |  T
 TA        TA       G  A
 AT       G  G      A  G
 TA        TG        AT
 TA        AT        CG
 GC        GT        AT
                        TTTTATGTCTATTTTGAATAGAGATAGTTAAtgtatacccacatttaattgttattgtaaaggttaatattagtATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[U] COG0681 Signal peptidase I ... can be seen here

    ..................................................................................................................