                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATCTCAGCAACTAATTCATCACTCTCTTTCTTAAGAATATGTATTTTATTAAATCCA
GGAATAAATTCAGTATAAGAACAAACATCATTTACTATATTGAACATCTGTTCCACAC
TATACGGAGCAACTGCAAAACATTTAATATGAAACATacttatgtttatctatattattatgataatatatgt
tatttattagaataatatatatatttttgcgcataaatattatattacaataataattaatagctaaatacttaaaataaatatactaatacagtgaatc
aatttaaactaATG

    smpB Gene: smpB     GI: 33519995     BI number: Bfl548     GOG: COG0691     Description: small protein B; putative tmRNA-binding protei            ta ct       t  t a  t       at Ta        ta At        at        tt Cg       t  |      a  a At        cg        tg At        ta        ta At        at        ta |  a      t  |       at |  t       ta        ta |  c       ta        ta Gt        gt        gt Ta        ta        ta At        at        at Ta        ta        ta At       t  t       at At        cg        ta Ta        at        at                         atttttgcgcataaatattatattacaataataattaatagctaaatacttaaaataaatatactaatacagtgaatcaatttaaactaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0691 tmRNA-binding protein ... can be seen here     ..................................................................................................................