                                                                        Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atattattgttacaagatgtgtaagtatactgatatgtatatgtattgtgattattaatattttattgtatataatttttacggtgattatatcgttata
tatttcatagacaatatatgagatatgtagggttatttaaattatttattagagcattaagtttattaatttgattatgtttttggttttttaatataaa
ttgtgtatcatcaatctttccatgggaatctattctgatttttgattattttaattcaaattttattatgtaataatcattaagaaatagtggtatagat
ATG

    corA Gene: corA     GI: 33520020     BI number: Bfl577     GOG: COG0598     Description: magnesium and cobalt transport protei ta t  t       tt t  t      a  a tg        gt at        ta         a ta        gt       c  a at        gc       a  t |  a       cg       g  a at        at        at ta       t  |       ta ta       t  |       at at       t  |       cg t  t      t  |       ta t  t      t  |       tg at       a  |       ta gt        at        at ta        ta        ta gc        at        at tg        ta        tg tg        at        at at        ta        ta tg        gt        tg                         ggttatttaaattatttattagagcattaagtttattaatttgattatgtttttggttttttaatataaattgtgtatcatcaatctttccatgggaatctattctgatttttgattattttaattcaaattttattatgtaataatcattaagaaatagtggtatagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0598 Mg2+ and Co2+ transporters ... can be seen here     ..................................................................................................................