Gene putatively regulated by attenuation in B_floridanus
Characteristics of the secondary structures
Terminator: Distance from promoter:102 nt. Distance to gene:32 nt. Distance to run of Ts=0 nt. Size=40 nt. Delta G=-11.20 kcal/mol
Antiterminator: Distance from promoter:79 nt. Size=40 nt. Delta G= -4.30 kcal/mol
Anti-antiterminator: Distance from promoter:64 nt. Size=34 nt. Delta G= -3.80 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGAGT-TTAAAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGAGTATTAATTAAATATCCATTTAAATCAGTAATAATATTCGTTTTATCTTGGTTC
ATgtattattacaccatatattaaattatgtgtaaattttgataataatagtatatatattatcttgattatagagtagtatcaatatatatagtgtat
attgatatgtattttttattaattatattgtataatatatactcaattttGGA
pgsA --- Cys
Gene: tRNA-Ser3 GI: Bfl417 BI number: Bfl417 GOG: ------- Description: tRNA-Ser
Gene: tRNA-Lys2 GI: Bfl416 BI number: Bfl416 GOG: ------- Description: tRNA-Ly
t
a t a
g a t g
t t a t
a ta tg
t t cg at
g a ta ta
at | g at
ta at ta
a | ta at
at tg at
ta at cg
at ta ta
at at at
ta | c ta
at | a gt
gc ta | g
t t at at
t t ta ta
tg at gt
ta ta at
at gt gt
tttattaattatattgtataatatatactcaattttGGA
..................................................................................................................