Gene putatively regulated by attenuation in B_floridanus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=41 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=41 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-taaaaa. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgattaaataaaataatatgataaaaattttaattatgaataaatgaaaggatataaatcaatattacattctatggattagattgtttatggttt
gacatatttagtggctgctgatatttgggtgtgttagtaatgcttttttagagaagaataagggcaaaaaaataatagtttttatgttattgaataaagt
tttttgttattaagtttttttaacgattattatagatataaagattattttagaaaaaattgttgtatttatgacttgcaataatgttaGCG

    Leu1 --- tRNA --- Pro --- tRNA


Gene: tRNA-Arg1     GI: Bfl585     BI number: Bfl585     GOG: -------     Description: tRNA-Arg
Gene: tRNA-His     GI: Bfl584     BI number: Bfl584     GOG: -------     Description: tRNA-His
Gene: tRNA-Leu1     GI: Bfl583     BI number: Bfl583     GOG: -------     Description: tRNA-Leu
Gene: tRNA-Pro     GI: Bfl582     BI number: Bfl582     GOG: -------     Description: tRNA-Pr


           tt
  g       t  g
g  a      g  a
t  t       gc
 at        ta
 ta        at
 cg        ta        gg
 ta       t  t      t  g
t  t      t  t      t  t
 at        gt        tg
 cg        ta        at
 at        tg        tg
t  t       at        at
t  t      |  g       gt
a  a      |  g       ta
t  |      |  c       cg
a  |      |  t       gt
 at       |  g       ta
 cg        gc       |  a
 tg        at       |  t
 at        tg        cg
 at        ta        gc
 at        at        gt
                        tttttagagaagaataagggcaaaaaaataatagtttttatgttattgaataaagttttttgttattaagtttttttaacgattattatagatataaagattattttagaaaaaattgttgtatttatgacttgcaataatgttaGCG
    ..................................................................................................................