                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-26.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTACCGAGAACGAACTGCTCAAGACCCCGAACCTGGGCCGCAAGTCGCTCAACGAG
ATCAAGGAAGTGCTGGCCGCACGCGGCCTGACCCTTGGCATGAAGCTGGAAAACTGGC
CCCCGCTGGGCCTCGAGCGTCCGTAAgcagtcaagcgcggtgggcgcgccatgcgcccgccgcgatgttttcatgcatcgg
aaggtgcatactttttccaccggaccgcggcctgtcacagaccgatagaagagccggataacccgatggcggaaacgccgtccttagattcaaaggaaat
atcATG

    BB0058 Gene: BB0058     GI: 33599051     BI number: BB0058     GOG: COG0203     Description: 50S ribosomal protein L1   G        CG C  C      C  T C  T      T  A CG       G  A CG        Cg CG        Gc GC       |  a GC       A  g        c T  |      G  t      c  a C  |      C  c      g  t A  |      T  a       cg A  |      C  a       gc A  |       Cg        cg AT        Gc        gc GC       G  g       gc G  G       Gc        gc TA        Tg        tg CG        Cg        gc GC        Gt        gc A  G       Cg        cg AT        Cg        gc GC        Cg        cg                         atgttttcatgcatcggaaggtgcatactttttccaccggaccgcggcctgtcacagaccgatagaagagccggataacccgatggcggaaacgccgtccttagattcaaaggaaatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0203 Ribosomal protein L17 ... can be seen here     ..................................................................................................................