Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGGCGCGCCGGCAGGCGGCAACTGGTCCAGACGGGCTGCCGAAATGTAAAAAGAGG
CGCGATGTAGGAGGGACACggtggagtccgatacggttggtttcgatccctattgtataatccggcgtttgcaacattagtctccg
cgcgcggggctggcttttttgcgttcgaggacgctggccggcgtcgatgccagggctggatggggcggagacgttttcgtccactctcgcagccgcgcgg
gcaggcatgggagggcgctttaggcgccttgatcgagtccgatcgtcgaggatttcATG

    BB0065


Gene: BB0065     GI: 33599058     BI number: BB0065     GOG: COG2863     Description: putative cytochrome C precurso


 cg
t  a
t  t
t  c
 gc
 gc
t  t
 ta
 gt
 gt
 cg
 at
 ta         a
 at       c  t
g  a      a  t
c  a      a  a       gc
c  |       cg       c  g
t  |       gt        gc
g  |      t  c       cg
 at       t  t       cg
 gc       t  c      t  |
 gc        gc        cg
 tg        cg        tg
g  g       gc        gc
 gc       |  g       at
 Cg        gc        tg
 At        cg        tg
                        cttttttgcgttcgaggacgctggccggcgtcgatgccagggctggatggggcggagacgttttcgtccactctcgcagccgcgcgggcaggcatgggagggcgctttaggcgccttgatcgagtccgatcgtcgaggatttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2863 Cytochrome c553 ... can be seen here

    ..................................................................................................................