                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGGCGCGCCGGCAGGCGGCAACTGGTCCAGACGGGCTGCCGAAATGTAAAAAGAGG
CGCGATGTAGGAGGGACACggtggagtccgatacggttggtttcgatccctattgtataatccggcgtttgcaacattagtctccg
cgcgcggggctggcttttttgcgttcgaggacgctggccggcgtcgatgccagggctggatggggcggagacgttttcgtccactctcgcagccgcgcgg
gcaggcatgggagggcgctttaggcgccttgatcgagtccgatcgtcgaggatttcATG

    BB0065 Gene: BB0065     GI: 33599058     BI number: BB0065     GOG: COG2863     Description: putative cytochrome C precurso cg t  a t  t t  c gc gc t  t ta gt gt cg at ta         a at       c  t g  a      a  t c  a      a  a       gc c  |       cg       c  g t  |       gt        gc g  |      t  c       cg at       t  t       cg gc       t  c      t  | gc        gc        cg tg        cg        tg g  g       gc        gc gc       |  g       at Cg        gc        tg At        cg        tg                         cttttttgcgttcgaggacgctggccggcgtcgatgccagggctggatggggcggagacgttttcgtccactctcgcagccgcgcgggcaggcatgggagggcgctttaggcgccttgatcgagtccgatcgtcgaggatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2863 Cytochrome c553 ... can be seen here     ..................................................................................................................