Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGGGCATTCCGGGCCAGTATCCCCGCCTGTCGGGACAGTTTTCGTCGTACATCGA
AGAACAGCTCAAGCTGTTCCGCAGCGGCGAGCGTGGCAATAGCGTGCCCATGCACGAC
ATCGCGGACCGTATGTCCGACGCCGATATCAAGGCTGTCGCCGATTACGCCGCGGGCT
TGCGCTGAccgggcctgagacgggcgcggccaggtgccgcgccagaatttaaccgggcgccggaacaagtttgccgagcccgttgtctatgagg
ggggaagccgattgcgcggccccccttttttcATG

    BB0066 --- BB0067


Gene: BB0066     GI: 33599059     BI number: BB0066     GOG: COG1333     Description: putative membrane protein
Gene: BB0067     GI: 33599060     BI number: BB0067     GOG: COG0755     Description: putative cytochrome c asssembly protei


            c
          t  t
          g  a
          t  t
 ag       t  g       tg
a  t      g  a      t  c
c  t       cg       a  g
a  t       cg        gc
a  g       cg        cg
 gc       g  |       cg
 gc       a  |       gc
 cg       g  |      a  |
c  a       cg       a  |
g  |       cg        gc
 cg       g  g       gc
 gc        ta        gc
 gc        ta        gc
 gc        tg        gc
 cg        gc        gt
                        tttttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG1333 ResB protein required for cytochrome c biosynthesis ... can be seen here
[O] COG0755 ABC-type transport system involved in cytochrome c biogenesis, permease component ... can be seen here

    ..................................................................................................................