                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-27.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-25.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCGACCTGGCCCAGGCCAAGAACGATGGCGTGGTGACCTTCGGCAACCTGGACTAC
CCGCCGCAACACGGCTGAtccccccggcgcccccctcgccgcagccgtaagtgccggcgcccgccctgtacagagggacgggcgccg
ttttttttgcctccgccatgcaggcgtcggaacggtggaaaatttcgacgatttgattgattatttccatcaaaacgacgttttcaccgctacatatcga
cagcagcgctcgttagcatggttgcatgcccgcaaccctcgcccgggagcacgccATG

    BB0097 Gene: BB0097     GI: 33599090     BI number: BB0097     GOG: COG1748     Description: putative dehydrogenas   c c  c c  c c  t gc cg gc gc cg c  | c  | c  | c  | c  | t  | A  | Gc                  ac Ta                 t  a Cg                 g  g Gc                  ta Gc                  cg Cg                  cg At        cc        cg |  a      g  c      |  a C  a       cg        gc A  g       gc        cg At        gc        cg Cg       |  c       cg |  c      c  t       gc Gc        cg        cg Cg        gt        gc Cg        ta        gc Gc        gc        cg                         ttttttttgcctccgccatgcaggcgtcggaacggtggaaaatttcgacgatttgattgattatttccatcaaaacgacgttttcaccgctacatatcgacagcagcgctcgttagcatggttgcatgcccgcaaccctcgcccgggagcacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1748 Saccharopine dehydrogenase and related proteins ... can be seen here     ..................................................................................................................