                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-12.21 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCGGTCCAGCCCGTGAAACGGTTTTCCAGGTTCCACTGGCTTTCGCCGTGGCGCAT
CAGAACAAGTTTGTACATggtgtaggccgcaacctgagcgggttaaagttgaacaatgcggtcattttataattgactggtttttct
ctgcttttccccctggcccgccctgtttcgcggcgcggccgggccgttgtttccaggctcgcgccgcccccctaggatgccctgtggatttactgcaatt
cttgatcgataaaaacaacgtcttcatcgtcgccgtggccgtggtgtcgggcatcATG

    BB0297 --- grxC --- secB --- gpsA --- BB0293 Gene: BB0297     GI: 33599286     BI number: BB0297     GOG: COG0607     Description: conserved hypothetical protein Gene: grxC     GI: 33599285     BI number: BB0296     GOG: COG0695     Description: glutaredoxin 3 Gene: secB     GI: 33599284     BI number: BB0295     GOG: COG1952     Description: protein-export protein Gene: gpsA     GI: 33599283     BI number: BB0294     GOG: COG0240     Description: glycerol-3-phosphate dehydrogenase [NAD(P)+] Gene: BB0293     GI: 33599282     BI number: BB0293     GOG: COG3181     Description: putative exported protei                      ag                     g  c                      tg                      cg TC                  cg T  C       GT        at G  A      A  T      |  t GC        AT       |  a AT        CG       |  a CG        AT       |  a CG       |  A      |  g |  C      A  C      |  t |  T      G  A      |  t T  T       AT       |  g T  T       Cg       |  a T  C       Tg       |  a TG        At       |  c GC        Cg       |  a GC        Gt       |  a CG       |  a       at AT       |  g       cg A  G       Cg        gc A  G       Gc        cg GC        Gc        cg TG        Tg        gt GC        Gc        gc                         attttataattgactggtttttctctgcttttccccctggcccgccctgtttcgcggcgcggccgggccgttgtttccaggctcgcgccgcccccctaggatgccctgtggatttactgcaattcttgatcgataaaaacaacgtcttcatcgtcgccgtggccgtggtgtcgggcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here [O] COG0695 Glutaredoxin and related proteins ... can be seen here [U] COG1952 Preprotein translocase subunit SecB ... can be seen here [C] COG0240 Glycerol-3-phosphate dehydrogenase ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................