Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-24.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGAGCTCGAAGCCTACCCCAGCGGCCCGGCTGCCTGGCGCCCCGGCCTGATGGAGC
CGGGCGGCGAACGTGCTGCCGCGCCGTGGCCGTTTCGCGCCGTCGCCCACGCCCGCTA
CCAGGCGCTCAGCGCCCGCGACAAGCTGCTGCTCGAACAGCTCGTGCGCACCTTCATC
GACGCCTGCCATGCCGACTACGGCCGCGCGCCGCCGTGGCCGCGCGAGCGCTGAacgcgg
cccgcgatatggaataatgcccctgccgcgccccaccgggcgcgcgcctttatttcagcgagatacATG

    BB0307


Gene: BB0307     GI: 33599296     BI number: BB0307     GOG: COG1743     Description: putative DNA methylas


 CG
G  A
 CG
 GC         g
C  |      g  a
 CG        ta
 GC        at
 GT        ta
 TG       a  a
|  A       gt
G  a       cg        ac
C  c       gc       c  c
 Cg       |  c       cg
 Gc       |  c       cg
 Cg       c  c       cg
 Cg       c  t       gc
 Gc        cg        cg
C  c       gc        gc
 Gc        gc        cg
 Cg        cg       |  c
 Gc        gc        cg
 Cg        cg        gc
                        ctttatttcagcgagatacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG1743 Adenine-specific DNA methylase containing a Zn-ribbon ... can be seen here

    ..................................................................................................................