                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGGCCTCGCGCACCGGCGTCTGGCTCACGCCCAGGCGTTCGGTCAGCATGCGCAGC
GTGAGGATCTCGCCAGGCTTGAGCTCGCCCATCATCAGCAGCTGCTTGAGCTGGCGAT
AGATGACGGCGGCAATGTTTTCGCGCGCCATGGGCGCGAGCGGCATGTTCATGGAAGG
TGGAATCGGCGCAAAAAGGGGGCGGTTGGCCGATGTTGCCATattccacggcaacccgctatactttat
aaaatataaattactaaatagccgcgacggcgcggccatcattcaggacgaggcctcATG

    BB0337 --- BB0336 --- BB0335 --- BB0334 Gene: BB0337     GI: 33599326     BI number: BB0337     GOG: COG0028     Description: putative acetolactate synthase large subunit Gene: BB0336     GI: 33599325     BI number: BB0336     GOG: COG1028     Description: putative acetoacetyl-CoA reductase Gene: BB0335     GI: 33599324     BI number: BB0335     GOG: COG3181     Description: putative exported protein Gene: BB0334     GI: 33599323     BI number: BB0334     GOG: -------     Description: putative membrane protei   C G  A       AT CG       C  C GC       T  A TG       A  G AT       C  C CG       C  A G  A       CG A  G       GC CG       C  T TA       T  | GT        CG GC        GC C  T       AT T  |      G  T       GA T  |      T  G      A  T GC        TA       T  G CG        CG       A  A GC       G  |       GC GC        GC        CG A  A       AT       G  G C  |       CG        GC CG        CG        TG CG        GC        CG GC        CG        GC                         AATGTTTTCGCGCGCCATGGGCGCGAGCGGCATGTTCATGGAAGGTGGAATCGGCGCAAAAAGGGGGCGGTTGGCCGATGTTGCCATattccacggcaacccgctatactttataaaatataaattactaaatagccgcgacggcgcggccatcattcaggacgaggcctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................