Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions

CGCGCGTGCTCGAACTGTTCGACATCGAAGTGCCGGGCCCGCACTGGGCCGGCATGTA
Gcgcgccccgtatccgcccgcgcccgtaccgaagcctgtccccgtggggcaggcttgtttgcgtctgagcgcgagaagccgcggcagggaatcccccgat
attgacaccggacaattattcagtactatgcgcaattaattcagtgtactgagtagaagcatagaagcacctggctgtttgttgttccgatcaagatcca
gccgcccgcattctgcgggcggcggccacaaggggaatacagATG

    BB0388 --- BB0389 --- BB0390 --- BB0391 --- BB0392 --- BB0393


Gene: BB0388     GI: 33599377     BI number: BB0388     GOG: COG3181     Description: putative exported protein
Gene: BB0389     GI: 33599378     BI number: BB0389     GOG: NOG43948     Description: 4,5-dihydroxyphthalate decarboxylase
Gene: BB0390     GI: 33599379     BI number: BB0390     GOG: COG1319     Description: molybdopterin dehydrogenase
Gene: BB0391     GI: 33599380     BI number: BB0391     GOG: COG2080     Description: probable 2Fe-2S ferredoxin
Gene: BB0392     GI: 33599381     BI number: BB0392     GOG: COG1529     Description: probable dehydrogenase/oxidase
Gene: BB0393     GI: 33599382     BI number: BB0393     GOG: COG3427     Description: conserved hypothetical protei


           g
         c  t
          cg
          cg
          cg
          tg
          gc
          ta
          cg
          cg
          gc
            ttgtttgcgtctgagcgcgagaagccgcggcagggaatcccccgatattgacaccggacaattattcagtactatgcgcaattaattcagtgtactgagtagaagcatagaagcacctggctgtttgttgttccgatcaagatccagccgcccgcattctgcgggcggcggccacaaggggaatacagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here
[C] COG1319 Aerobic-type carbon monoxide dehydrogenase, middle subunit CoxM/CutM homologs ... can be seen here
[C] COG2080 Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs ... can be seen here
[C] COG1529 Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs ... can be seen here
[S] COG3427 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................