Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-28.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGTGGAACAAAACAGGGACACAAGAGTACAAGCAGCAAACTTGCTCACGCGGGAAAT
CATggattcctccctggagccgcccggctcgcacagccttgcgcggcggccctatgcgccggcgcccgtcggccggcttccaatgatctgccaaaccg
atgcgcgtagcaagttccctgctggcgcattgcggcacaagtggccaccaatgtttacggcctaggctgttttatgggttgcgcgcccgtcgcgggccgg
cttatggtgtaactgcagcggcgcaagcgccgctacaggagaccATG

    BB0407


Gene: BB0407     GI: 33599396     BI number: BB0407     GOG: -------     Description: putative exported protei


            t
          t  c
          g  c
          a  c
           at
           cg
           gc
           at
           tg
          g  |
           cg
           gc
           cg
           gc
           ta
           at
           gt
           cg
          c  c
          a  |
 aa       a  |
c  t      a  |
 cg        cg
 ta        cg
|  t       gc        tg
|  c       ta       a  t
t  t      c  c      a  t
 cg       t  |      c  t
 gc       a  |      c  a
 gc       g  |      a  c
|  a      t  |       cg
c  a      a  |       cg
c  a      a  |       gc
 gc       c  |       gc
 gc       c  |      t  t
 cg        ta       g  a
 ta        ta       a  g
 gt        cg       a  |
 cg       g  |      c  |
c  c       gt       a  |
 cg        cg        cg
 gc        cg        gc
 cg        gc        gt
 gt        gc        cg
                        ttttatgggttgcgcgcccgtcgcgggccggcttatggtgtaactgcagcggcgcaagcgccgctacaggagaccATG


    ..................................................................................................................