Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGCTGTTGGCTTCGACCACGCGCACGAAGACCTGCATGGCTTGGAAACGGTCCATg
gcggcgtcctgaataagtgtgtgcgcaaagcataacgctgttttggcctggattgttcgtccggaacaaacagtgttgacggccagccattgtttatccg
gaccgacaaaacactcagaatttgtccatccgaatcgcccgccggctctccagccgtccgtcgcacccccggggcgctgcgctcgcagccccggccggcg
gggcccgtttctcccctatcagcccagtttcaaggaaacaccATG

    BB0437 --- BB0436 --- BB0435


Gene: BB0437     GI: 33599426     BI number: BB0437     GOG: COG0845     Description: HlyD family secretion protein
Gene: BB0436     GI: 33599425     BI number: BB0436     GOG: COG0841     Description: putative multidrug-efflux system protein
Gene: BB0435     GI: 33599424     BI number: BB0435     GOG: COG1538     Description: putative exported protei


 AA
G  A
 GC
 TG
 TG
C  T        a
 GC       a  t
 GC       g  a        a
 TA        ta       c  a
 AT        cg       g  a
|  g      c  t       cg
 Cg       t  g       gc
 Gc        gt        ta
 Tg        cg        gt
 Cg        gt       |  a
|  c      |  g       ta
 Cg        gc        gc
 At        cg        tg
 Gc        gc        gc
                        tgttttggcctggattgttcgtccggaacaaacagtgttgacggccagccattgtttatccggaccgacaaaacactcagaatttgtccatccgaatcgcccgccggctctccagccgtccgtcgcacccccggggcgctgcgctcgcagccccggccggcggggcccgtttctcccctatcagcccagtttcaaggaaacaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0845 Membrane-fusion protein ... can be seen here
[V] COG0841 Cation/multidrug efflux pump ... can be seen here
[MU] COG1538 Outer membrane protein ... can be seen here

    ..................................................................................................................