                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCTGGCGGGCTGCAACACCATGTCGGGCGCCGGCAAGGACATCGAGCGCGGCGGC
GAAAAAATCCAGGAGAAGGCGCAGTAGcagcacctcggccggggcgcgttgccgctccggcaaatccgcacgacaggcgc
gcgaacgcgcgttccacgcatcgcgtcatccagacgctgtccggcatcgcgccgggcgcaggcgattttttcaaacgcaatgtactactaggtcgagatc
attcctactcgaccaagctgatggcgcctgcatctttcgatgccgaatctccctaggatttcTTG

    BB0452 --- BB0453 Gene: BB0452     GI: 33599442     BI number: BB0452     GOG: COG3468     Description: autotransporter Gene: BB0453     GI: 33599443     BI number: BB0453     GOG: -------     Description: conserved hypothetical protei             c         c           t  c      t  g   c       a  a      a  c t  c       cg        cg t  a       ta        gc gc        gc        gc cg        cg        cg gc        gc        cg c  a      c  |       tg g  |      t  |       gc c  |       at       |  g a  |       cg       |  c at        gt       |  a gc       c  c       tg cg       a  c       cg gc        cg        gc cg        cg        cg                         attttttcaaacgcaatgtactactaggtcgagatcattcctactcgaccaagctgatggcgcctgcatctttcgatgccgaatctccctaggatttcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MU] COG3468 Type V secretory pathway, adhesin AidA ... can be seen here     ..................................................................................................................