                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcattacctacggtgaacttgtgaggcatatgaatgactactggagaatatttgttggggcggtttggaccgttgatgagcatcgttgacgttgccacc
ttgctaggtcgatctcccgatggcgtccgcgttgcgctttataccgataccgacttttcgcgcaagttgaaaccagccatgctgcgagtcggccgccgcg
tttattttcggacgttgcaggtcacggaagcgctgaatctggaacagccgacagacgatgaaatcacgcccgcagaggtcgctacacgagggccgcgcac
ATG

    BB0495 --- BB0494 --- virD2 --- BB0492 Gene: BB0495     GI: 33599486     BI number: BB0495     GOG: NOG47588     Description: hypothetical protein Gene: BB0494     GI: 33599485     BI number: BB0494     GOG: NOG40491     Description: hypothetical 20.3 kDa protein Gene: virD2     GI: 33599484     BI number: BB0493     GOG: COG3843     Description: plasmid-related protein Gene: BB0492     GI: 33599483     BI number: BB0492     GOG: -------     Description: hypothetical protei ta a  c       aa gc       a  c cg        gc c  a       ta a  c       tg t  t       gc a  t      |  c t  t      a  a t  t       at t  c       cg cg        gc         c gc       |  t      t  g cg        cg       g  g gc        gc       a  c ta        cg        gc ta        ta        cg g  |      t  |       gc cg       t  |      t  c gt       t  |       cg c  t       cg        gc cg        at        tg ta        gc        at                         ttattttcggacgttgcaggtcacggaagcgctgaatctggaacagccgacagacgatgaaatcacgcccgcagaggtcgctacacgagggccgcgcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG3843 Type IV secretory pathway, VirD2 components (relaxase) ... can be seen here     ..................................................................................................................