                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=1 nt.   Size=19 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.71 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGACAGGGTCCGATTCCCGCATATCGAGTTTTTTACAGGGTATCCCGCTGATCACAT
CGTCAATGATGCGAGCATAAGCTGGGAAGGCAAGGAAGTATATATTTCAGGGCCACCG
CCGATGGTGGATCATACGGTCAGGCAGCTGATGATCAACACAGAGATCGATGCGCTTG
ATATCAAGTGCGATAGTTTTGTTTGAagttgggatggttcattaaaaactcaaaccctgaaatcttcggaaatattttttc
aaagggcagtgaaaaaatcactgcatattttaataaaggttctctGTG

    BB0523 --- BB0524 --- BB0525 Gene: BB0523     GI: 33599513     BI number: BB0523     GOG: COG2146     Description: putative ferredoxin Gene: BB0524     GI: 33599514     BI number: BB0524     GOG: COG0693     Description: conserved hypothetical protein Gene: BB0525     GI: 33599515     BI number: BB0525     GOG: COG3181     Description: conserved hypothetical protei   t g  t gc ta at gt        tc |  a      t  g g  a       cg g  a       ta ta       |  a ta       |  a gc       |  t a  |      |  a At       |  t Gc       |  t Ta       |  t Ta        at Ta        at Gc        at |  c       gc |  c      |  a |  t      |  a Tg        ta         a Ta        cg       a  a Ta        cg       a  a Ta        cg        at Gt       |  c       gc A  c      a  a       ta T  t      a  g       gc At        at        at Gc        cg        cg Cg        ta        gc                         atattttaataaaggttctctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PR] COG2146 Ferredoxin subunits of nitrite reductase and ring-hydroxylating dioxygenases ... can be seen here [R] COG0693 Putative intracellular protease/amidase ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................