                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-30.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCATGCCGTTCGATGACGAGCTGTAGGAGAGGATGCGCAGAATCTCCAGGGCGCGCC
TGACGCTTTGCACGGTGTCGCCGCCGCCGGCCCGCGTGGTGCCGTTGTCCTCCATtgct
gtctcctgcctgtccgttgcggcggcgcgcccgcccgggcgcgccgccattttttctggctgttggtactagtgttccgtatcgcggaactttttaggcg
tatccgcgattttgccgcgtttcgtttctagagtccaaacccagtcccggcggcgtcgccgcgttcggggaggaggcaaggacATG

    BB0656 --- BB0657 --- BB0658 --- BB0659 --- BB0660 Gene: BB0656     GI: 33599646     BI number: BB0656     GOG: COG1960     Description: probable acyl-CoA dehydrogenase Gene: BB0657     GI: 33599647     BI number: BB0657     GOG: COG0318     Description: putative acetyl-CoA synthetase Gene: BB0658     GI: 33599648     BI number: BB0658     GOG: NOG46378     Description: conserved hypothetical protein Gene: BB0659     GI: 33599649     BI number: BB0659     GOG: COG2030     Description: conserved hypothetical protein Gene: BB0660     GI: 33599650     BI number: BB0660     GOG: COG3181     Description: putative exported protei             t           t  t           t  t           t  c            at            cg            cg            gc           |  t           |  g           |  t           |  t            cg cc        cg g  c       gt cg       |  a cg       |  c cg       |  t gc       |  a        t cg        cg       a  c gc        gt       t  g cg        cg        gc gc       |  t       cg gc        gt        cg cg        gc        ta gc        gc        ta gc        cg        gc                         tttttaggcgtatccgcgattttgccgcgtttcgtttctagagtccaaacccagtcccggcggcgtcgccgcgttcggggaggaggcaaggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here [I] COG2030 Acyl dehydratase ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-30.40 kcal/mol Antiterminator: Size=15 nt.     Delta G= -7.50 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G=-15.92 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCATGCCGTTCGATGACGAGCTGTAGGAGAGGATGCGCAGAATCTCCAGGGCGCGCC TGACGCTTTGCACGGTGTCGCCGCCGCCGGCCCGCGTGGTGCCGTTGTCCTCCATtgct gtctcctgcctgtccgttgcggcggcgcgcccgcccgggcgcgccgccattttttctggctgttggtactagtgttccgtatcgcggaactttttaggcg tatccgcgattttgccgcgtttcgtttctagagtccaaacccagtcccggcggcgtcgccgcgttcggggaggaggcaaggacATG     BB0656 --- BB0657 --- BB0658 --- BB0659 --- BB0660 Gene: BB0656     GI: 33599646     BI number: BB0656     GOG: COG1960     Description: probable acyl-CoA dehydrogenase Gene: BB0657     GI: 33599647     BI number: BB0657     GOG: COG0318     Description: putative acetyl-CoA synthetase Gene: BB0658     GI: 33599648     BI number: BB0658     GOG: NOG46378     Description: conserved hypothetical protein Gene: BB0659     GI: 33599649     BI number: BB0659     GOG: COG2030     Description: conserved hypothetical protein Gene: BB0660     GI: 33599650     BI number: BB0660     GOG: COG3181     Description: putative exported protei ct t  c g  c t  t cg gc t  c T  | At Cg C  t T  c C  c C  g T  t                 cc G  t                g  c T  |                 cg Tg                  cg Gc                  cg Cg                  gc Cg         c        cg Gc       g  g       gc Tg       c  c       cg G  g       gc        gc Gc        gc        gc Tg        cg        cg Gc        gc        gc Cg        gc        gc                         attttttctggctgttggtactagtgttccgtatcgcggaactttttaggcgtatccgcgattttgccgcgtttcgtttctagagtccaaacccagtcccggcggcgtcgccgcgttcggggaggaggcaaggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here [I] COG2030 Acyl dehydratase ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................