Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGGGCGGTTGAAACGATTACGGCTTCTCTCATcgctgtctccttgttgtgcctgggatgtgaggatggagacg
actatatcgacggccgaaatcgggcggcaaccgactatttcgcagcggtggctcagtttttctcagccaggtttcttctggttgagtttttgtaggccag
cgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatc
cataaaacagtgacaggagacaaccATG

    BB0666 --- BB0667 --- BB0668


Gene: BB0666     GI: 33599656     BI number: BB0666     GOG: COG3181     Description: putative exported protein
Gene: BB0667     GI: 33599657     BI number: BB0667     GOG: COG1042     Description: putative acetyl-CoA synthetase
Gene: BB0668     GI: 33599658     BI number: BB0668     GOG: COG1042     Description: conserved hypothetical protei


  t
t  c                  t
t  g                t  c
a  c                t  t
 ta         t        gt
 cg       t  t       gc
a  |      t  t       at
 gc        gc        cg
 cg        at        cg
 cg       c  c       gt
 at        ta        at
a  g       cg        cg
 cg        gc        ta
 gc        gc        cg
                        tttttgtaggccagcgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatccataaaacagtgacaggagacaaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here
[C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here
[C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGGGCGGTTGAAACGATTACGGCTTCTCTCATcgctgtctccttgttgtgcctgggatgtgaggatggagacg
actatatcgacggccgaaatcgggcggcaaccgactatttcgcagcggtggctcagtttttctcagccaggtttcttctggttgagtttttgtaggccag
cgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatc
cataaaacagtgacaggagacaaccATG

    BB0666 --- BB0667 --- BB0668


Gene: BB0666     GI: 33599656     BI number: BB0666     GOG: COG3181     Description: putative exported protein
Gene: BB0667     GI: 33599657     BI number: BB0667     GOG: COG1042     Description: putative acetyl-CoA synthetase
Gene: BB0668     GI: 33599658     BI number: BB0668     GOG: COG1042     Description: conserved hypothetical protei



  t
t  c
t  g
a  c        t
 ta       t  t
 cg       t  t
a  |       gc
 gc        at
 cg       c  c
 cg        ta
 at        cg
a  g       gc
 cg        gc
 gc        ta
            ggtttcttctggttgagtttttgtaggccagcgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatccataaaacagtgacaggagacaaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here
[C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here
[C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here

    ..................................................................................................................