                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-16.50 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGCCGTCGTACCGCGCCGGGTCTACGCCCAGCTGCTGCAACAGGCGCCTGGTTTCC
TCGGGAGTCGCGCTATGCACTGTCGTCATgatctggatcctttcaggtgatggtcgcaagcggcgagcggcgcgggccg
cgcctccggcagatggctgccggaccgccagttttctattttatggaattcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggc
gcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG

    BB0676 Gene: BB0676     GI: 33599666     BI number: BB0676     GOG: COG1802     Description: putative GntR-family transcriptional regulato            cg           g  g            cg            gc            gc            cg            gc           a  |       tg           g  |      a  g            cg        gc   c        gc        at g  g       gc        cg g  a      c  t       gc cg       g  c       gc gc       a  c       cg |  g      a  g       cg a  g       cg        ta a  c       gc       c  c cg       |  a      c  | gc        cg        gc cg        ta        cg tg        gt        gc                         cagttttctattttatggaattcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggcgcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:125 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-18.60 kcal/mol Antiterminator: Size=41 nt.     Delta G=-16.50 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G=-21.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCCGCCGTCGTACCGCGCCGGGTCTACGCCCAGCTGCTGCAACAGGCGCCTGGTTTCC TCGGGAGTCGCGCTATGCACTGTCGTCATgatctggatcctttcaggtgatggtcgcaagcggcgagcggcgcgggccg cgcctccggcagatggctgccggaccgccagttttctattttatggaattcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggc gcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG     BB0676 Gene: BB0676     GI: 33599666     BI number: BB0676     GOG: COG1802     Description: putative GntR-family transcriptional regulato cc t  t at gt gc ta cg tg at g  | T  | A  | C  |       ag        tg T  |      g  c      a  g G  |       cg        gc Cg        gg        at Ta        gc        cg Gt        cg        gc Tg        gc        gc Cg       a  |       cg At       a  |       cg |  c       cg        ta Cg        gg       c  | Gc        cg       c  | Ta       t  c      g  | A  |      g  c      c  | Ta       g  g      g  | Cg       t  c      c  | Gc        ag       c  | |  g       gc       g  | Cg       |  c       gc Gc        tt        gc Cg        gc        cg Ta        gc        gc                         cagttttctattttatggaattcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggcgcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................