                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.30 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGTCCTCGGCCTGGCGCCGCAGGGGCATCGAGGCCTTGTCGTCGGTCGCGCCGTCG
TGGGGCACGTCGGGTTCCATCATTCTCATctactcgcatcaagggggcagcccggcagatagtagtgcaacgggtccgc
gcccgtctcgtgcgccggtgttgtgccgaagccgatttttcatttatcatatttttggaattgaattccataaaatagaaaactggcggtccggcagcca
tctgccggaggcgcggcccgcgccgctcgccgcttgcgaccatcacctgaaaggatccagatcATG

    BB0677 --- metC --- BB0679 Gene: BB0677     GI: 33599667     BI number: BB0677     GOG: COG1012     Description: probable aldehyde dehydrogenase Gene: metC     GI: 33599668     BI number: BB0678     GOG: COG0626     Description: cystathionine beta-lyase Gene: BB0679     GI: 33599669     BI number: BB0679     GOG: COG0251     Description: conserved hypothetical protei            cg           c  c            tg            gc            gc            gc            cg ag        at t  t      a  c a  a      c  t g  g       gc at        tg cg       g  | gc        at |  a       tg         t |  a       gc       t  g gc       a  |      g  t cg       t  |       tg cg       a  |       gc cg       g  |       gc gt       a  |       cg |  c       cg       c  a a  c       gc       g  a cg        gc        cg gc        cg        gc                         cgatttttcatttatcatatttttggaattgaattccataaaatagaaaactggcggtccggcagccatctgccggaggcgcggcccgcgccgctcgccgcttgcgaccatcacctgaaaggatccagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here     ..................................................................................................................