Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-30.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGCTGCGCTCGAGCCGCGCCATGCGGTTCTGCACCGTTCCGCGCGACACGTGCAGC
TGGCGGGCCAGCGTGGCGGTGGGCAGGCGGGCGTCCGCGCGCAGCAGCGCCAGCAGGC
GGCGGTCCAGGGCGTCGAGCGCATGATCCATGGCAGTCTCCAGGCCGTTTGGGCAGAT
CGCCAGCCGTAGCTGGCGATCTGCTCCATATTGCCTCAGGATTGCCATttttctggcttttcgc
tagccgggcatttccctaagatggtctgcaggccaggcaggaccatcccgcaggagaccgccATG

    BB0834 --- BB0835


Gene: BB0834     GI: 33599823     BI number: BB0834     GOG: COG4992     Description: ornithine aminotransferase
Gene: BB0835     GI: 33599824     BI number: BB0835     GOG: COG0010     Description: arginas



 GT        AT
C  A      C  A
 CG       C  T
 GC       T  T
 AT        CG
 CG        GC
 CG       |  C
 GC       |  T
 CG       |  C
 TA       |  A
 AT        TG
 GC        CG
 AT        TA
 CG        AT
 GC        GT
|  T       CG
 GC        GC
 GC        GC
 TA        TA
            TttttctggcttttcgctagccgggcatttccctaagatggtctgcaggccaggcaggaccatcccgcaggagaccgccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG4992 Ornithine/acetylornithine aminotransferase ... can be seen here
[E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here

    ..................................................................................................................