                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=18 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.13 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAGCGCGGCGCCGGCCAGCGCGCGCACGGAATCGGCCACGCCGCCGGCCGGATA
GCCCAGCTCTATCGTGAGGGCGGCCGGGTCCGCGGCCAGATGGATGTCACGATCTTTT
ACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGC
GGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaagga
tagcggatacgcgggaacctttagcctggttttacatccatatctacATG

    BB0841 Gene: BB0841     GI: 33599830     BI number: BB0841     GOG: -------     Description: putative exported protei   T T  T C  T T  A A  C G  A C  C A  A                  G C  A                C  C TA                 A  C GC                 A  C TA                  CG AT                  GC GT                  GC GC                 |  A TA                 |  A A  G                |  C GC                 C  G AT        GC       T  C |  C      T  G      A  G |  C       CG        GC |  A       TA        GC CG        GT        CG CG        GC        GC GC        CG        TG GC        CG        CG CG        GC        TA                         TTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaaggatagcggatacgcgggaacctttagcctggttttacatccatatctacATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:185 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-11.52 kcal/mol Antiterminator: Size=49 nt.     Delta G=-18.60 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-29.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGCCAGCGCGGCGCCGGCCAGCGCGCGCACGGAATCGGCCACGCCGCCGGCCGGATA GCCCAGCTCTATCGTGAGGGCGGCCGGGTCCGCGGCCAGATGGATGTCACGATCTTTT ACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGC GGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaagga tagcggatacgcgggaacctttagcctggttttacatccatatctacATG     BB0841 Gene: BB0841     GI: 33599830     BI number: BB0841     GOG: -------     Description: putative exported protei TC A  G A  G GC         A GC       C  G C  A      C  C A  |      C  T       TC C  |       GC       G  C GC        AT       G  G CG        TA        GC GC        AT        CG C  |       GC        CG GC       G  G       GC CG       C  T       GC GC       C  G      |  A A  C      G  A      |  G CG       G  G      |  A CG        CG       |  T GC        CG       |  G GC        GC       C  G CG        CG       G  A CG        CG       G  T |  A       GC       G  G |  T      C  C       AT G  A      A  G       GC CG        CG        TA GC        CG        GC GC        GT        CG                         ATCTTTTACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGCGGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaaggatagcggatacgcgggaacctttagcctggttttacatccatatctacATG     ..................................................................................................................