                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-12.39 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCGAGCCCGAGTTCGACGTCTGCCTGTGCGCCATCGCCAAGGTCGAGCGCCGCAT
CGACGCCGGCCCGCAGGAAGACCTGCGGCCGTTTTTCGGCCGCTACGAGCAGGCCGTC
GCGGCGCGCCGGCCCGACATCATTCGCTGAcgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattcc
ccgaggtcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagc
gcccgcATG

    BB0850 --- BB0851 --- sodA --- BB0853 Gene: BB0850     GI: 33599839     BI number: BB0850     GOG: COG1982     Description: probable orn/arg/lys decarboxylase Gene: BB0851     GI: 33599840     BI number: BB0851     GOG: COG2081     Description: putative exported protein Gene: sodA     GI: 33599841     BI number: BB0852     GOG: COG0605     Description: superoxide dismutase [Mn] Gene: BB0853     GI: 33599842     BI number: BB0853     GOG: COG0428     Description: probable metal transporte cc g  g cg gc cg g  | cg cg gc cg A  | Gc Ta |  c |  c |  c Cg Gc         t |  t      t  c |  t      a  c        c C  t      a  c      t  g T  c      c  c      c  t T  a      a  g       gc A  a       ta        cg C  t       cg        cg T  c       cg        cg A  c      t  t       gc Cg        gc        gc At        cg        cg Gc        cg        tg                         ttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1982 Arginine/lysine/ornithine decarboxylases ... can be seen here [R] COG2081 Predicted flavoproteins ... can be seen here [P] COG0605 Superoxide dismutase ... can be seen here [P] COG0428 Predicted divalent heavy-metal cations transporter ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.40 kcal/mol Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=30 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCGGCGAGCCCGAGTTCGACGTCTGCCTGTGCGCCATCGCCAAGGTCGAGCGCCGCAT CGACGCCGGCCCGCAGGAAGACCTGCGGCCGTTTTTCGGCCGCTACGAGCAGGCCGTC GCGGCGCGCCGGCCCGACATCATTCGCTGAcgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattcc ccgaggtcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagc gcccgcATG     BB0850 --- BB0851 --- sodA --- BB0853 Gene: BB0850     GI: 33599839     BI number: BB0850     GOG: COG1982     Description: probable orn/arg/lys decarboxylase Gene: BB0851     GI: 33599840     BI number: BB0851     GOG: COG2081     Description: putative exported protein Gene: sodA     GI: 33599841     BI number: BB0852     GOG: COG0605     Description: superoxide dismutase [Mn] Gene: BB0853     GI: 33599842     BI number: BB0853     GOG: COG0428     Description: probable metal transporte             A           C  T            GC            CG           C  A            GC            CG            GC           A  |            GC            CG            TG AA        GC C  G       GC CG       A  | GT       A  |       AG |  C      C  |      A  A CG       C  |       GC TA       G  |       GC |  G      C  |       AT A  C      T  |       CG C  G      A  |       GC C  C      C  |      C  | GC       C  |       CG CG        GC        CG GC        CG        GC TA        GC        GC GT        TA        CG                         TTTTTCGGCCGCTACGAGCAGGCCGTCGCGGCGCGCCGGCCCGACATCATTCGCTGAcgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattccccgaggtcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1982 Arginine/lysine/ornithine decarboxylases ... can be seen here [R] COG2081 Predicted flavoproteins ... can be seen here [P] COG0605 Superoxide dismutase ... can be seen here [P] COG0428 Predicted divalent heavy-metal cations transporter ... can be seen here     ..................................................................................................................