                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -5.43 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-11.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGAACGCCTGCACGACCTGCTCGACCAGCGAAGGCGCCTGCGCGCGGCCGCGCAC
GGGTTGGAAATCGATCACggaaggtctgccaggtagatttctgtacagttagccagaatccaactacacagttagcggtatttacgt
cgattgtatattttcattccctggcaggcgggccagaatcgatctcgtcccctgcccggccaccgcacgcgcggtcggcgcacaccgcaggcgttacctc
tggagcgaccctcatgaatgcccccgccagcccgcccgacctgtcgcatctctggATG

    BB0869 --- mmsA Gene: BB0869     GI: 33599858     BI number: BB0869     GOG: COG0161     Description: omega-amino acid--pyruvate aminotransferase Gene: mmsA     GI: 33599857     BI number: BB0868     GOG: COG1012     Description: putative methylmalonate-semialdehyde dehydrogenase [acylating   a c  g cg gt ta cg ta g  | gt         a at       c  a at       c  c gc       t  t gt       a  a Cg       a  c At       g  a        t C  a      a  c      a  t T  c      c  a      t  t A  a       cg       g  a G  g       gt        gc C  t       at        cg T  t       ta        gt A  a       tg       a  c A  g       gc       t  g A  |      a  g       ta Gc        cg        gt Gc        at        at Ta        ta        cg Tg        gt        at                         atattttcattccctggcaggcgggccagaatcgatctcgtcccctgcccggccaccgcacgcgcggtcggcgcacaccgcaggcgttacctctggagcgaccctcatgaatgcccccgccagcccgcccgacctgtcgcatctctggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................