Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCAGGTGGTGGGTCAGGACGGCGAGGCGATTCCGGGCTTGTACGCATGCGGAAAC
GATATGTCGTCGGTGTTTCGCGGGTTTTATCCGGGGGCAGGCGCCACGCTGGGTCCGG
GCCTGGTATTCGCGTATCGCGCCATCGAGCACCTGGCGCGGTCCTCAGGCGGATCGGC
CGCGCAATCCGCTTGAcagcacgagatggtctcatttaaaactattcacatgcataaaataaaattcacacatgtgaataaatagcgg
gcccggcatcgggacctgcccaccaccaggagaccatcGTG

    BB0971


Gene: BB0971     GI: 33599959     BI number: BB0971     GOG: COG3181     Description: putative exported protei


  c                   G
a  c                T  T
g  a                A  C
 at                  TG
 gc                  AT
g  G                 GC
 aT                  CG
 cG        AA       |  G
 cG       G  A      |  T
a  C       GC       A  G
c  A       CG        AT
c  |      |  A       AT
 aT        GT        GT
 cG        TA        GC
|  C       AT        CG
 cG        CG        GC
 cG        GT        TG
                        GGTTTTATCCGGGGGCAGGCGCCACGCTGGGTCCGGGCCTGGTATTCGCGTATCGCGCCATCGAGCACCTGGCGCGGTCCTCAGGCGGATCGGCCGCGCAATCCGCTTGAcagcacgagatggtctcatttaaaactattcacatgcataaaataaaattcacacatgtgaataaatagcgggcccggcatcgggacctgcccaccaccaggagaccatcGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................