Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGCGTGCATGGGGCGCGTGCAGGAACTCAAGACCCACGTGGGCGGCGCCGTCAACA
ATGGCTGCAATGTGGAGGAAATCCGTGCCGTCATGATGCAGGTCGCCATCTATTGCGG
TATTCCCGCGGGCGTGGAAGGCACGCGCACCGCCGAAGGCGTGCTGCGCGAACGCAAG
CTGATCGACTGAgcggcgcggacggcggcggccgcagcggcgcggggcttcgggtaaactgacgcaccttcgaactgtccgccgatccgct
cggcggcagcgggtttttgctacgaatggtctgccATG

    BB0972


Gene: BB0972     GI: 33599960     BI number: BB0972     GOG: COG1414     Description: probable transcriptional regulato



            c
          c  g
          t  c
  a        at
t  a       gc
g  a       cg
 gc        cg
 gt        gc
 cg        cg
 ta        cg
t  c      t  |
 cg        gc
 gc        ta
|  a       cg
 gc       a  |
 gc       a  |
 gt        gc
c  t       cg
 gc        tg
 cg        tg
            tttttgctacgaatggtctgccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1414 Transcriptional regulator ... can be seen here

    ..................................................................................................................