                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGCGTGCATGGGGCGCGTGCAGGAACTCAAGACCCACGTGGGCGGCGCCGTCAACA
ATGGCTGCAATGTGGAGGAAATCCGTGCCGTCATGATGCAGGTCGCCATCTATTGCGG
TATTCCCGCGGGCGTGGAAGGCACGCGCACCGCCGAAGGCGTGCTGCGCGAACGCAAG
CTGATCGACTGAgcggcgcggacggcggcggccgcagcggcgcggggcttcgggtaaactgacgcaccttcgaactgtccgccgatccgct
cggcggcagcgggtttttgctacgaatggtctgccATG

    BB0972 Gene: BB0972     GI: 33599960     BI number: BB0972     GOG: COG1414     Description: probable transcriptional regulato             c           c  g           t  c   a        at t  a       gc g  a       cg gc        cg gt        gc cg        cg ta        cg t  c      t  | cg        gc gc        ta |  a       cg gc       a  | gc       a  | gt        gc c  t       cg gc        tg cg        tg             tttttgctacgaatggtctgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1414 Transcriptional regulator ... can be seen here     ..................................................................................................................