                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGTCAGCCGCGTCGCTATCGACGGCATACGGTTCCGGCCGTTGGCCAAGGCGGGAG
TCGAGTCGCAGCTGCTGGGCGTGTGGCGCGACGACGGGCACGACAGCCTGATCCAGCC
GCTGCTCGCCGCCATGGCGTCGTTGCTGCCGGCCGCGCGTCGATGAtgtcttgctcgccggccatg
ttcgcggccgcgacgggcaacggcatcacgccgcgcgggtccgatcattgccaaatggtaatgagcgggtaataccgcctgcgcgtcttttgactacgat
ctgcccatcggcgcggcaATG

    BB0985 Gene: BB0985     GI: 33599973     BI number: BB0985     GOG: -------     Description: hypothetical protei at c  c g  a gc cg a  | a  | c  | g  | gc gc cg a  | gc cg gc        aa |  g      a  t cg        cg cg        cg gt        gt gc        ta        ta c  |       ta       a  c gc        at       a  c cg        cg        tg ta        ta        gc t  t      a  g       gc gc        gc        gt ta        cg        cg at        cg        gc                         gcgtcttttgactacgatctgcccatcggcgcggcaATG     ..................................................................................................................