                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-24.20 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-25.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-24.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCGAACTGATCGCCGACGAGCGCGGCGTGCCGCTGCCCGAAGTCGGCTATTACCGC
CTGCGCTTCCCCACCAAGCCGGTCACGCTGGGCGAGCTGGCCTCGCTGCCCCAGACCG
AGGCCTCGCGCCAGGCGGTGGTGCGCCTGAAGAAAACCGCCTGAcgcggccgcgcggcgcgcgtgcg
cgggaaaacagggccgcaagccgccccccgtggcgccgcgcgccacgggagcgtcatgttttcatcgtaaaatcccgtgctccccgcgctgctccggcgc
aatgccctgcgtcagggATG

    BB0991 Gene: BB0991     GI: 33599979     BI number: BB0991     GOG: COG2199     Description: putative membrane protei cg        aa g  c      c  g cg       g  c cg       c  c gc        cg |  g       gc gc        gc cg        gc gc       a  | cg       c  | At       a  | G  g      a  | T  c      a  |        g C  |      a  |      c  c Cg        gc        cg Gc        gc        gc Cg        gc        cg Cg        cg        gc A  g       gt        gc A  a      |  g       ta A  a       cg        gc A  a       gc        cg G  a       tg        cg A  |       gc        cg A  |      c  |      c  a Gc        gc       c  | Ta        cg        cg Cg        gc        gc Cg        cg        cg                         tcatgttttcatcgtaaaatcccgtgctccccgcgctgctccggcgcaatgccctgcgtcagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here     ..................................................................................................................