                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-15.07 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGCCTGGGCGCAGTGCTCAACGAGCGCTTCACGCCCTCGCAGCTCGCCGTCTGCGA
CTGAcgccccgcccggccgcaaagccgcgccgcctgcatataaataatttatggcggctgcgttttttttgatttgacgctgcgcggggcgtgaaac
accataggacacaagagcgagcaggccggcgcctggcgatcagccagtgccggaagacgtggtagttgactttcaggtagtacccggcagccggggcgcc
ccttgcgccccccggcacggacgcacactggacaggacaaacatcATG

    BB0999 --- BB0998 --- BB0997 --- BB0996 --- BB0995 --- BB0994 --- BB0993 --- BB0992 Gene: BB0999     GI: 33599987     BI number: BB0999     GOG: COG0687     Description: putative extracellular solute-binding protein Gene: BB0998     GI: 33599986     BI number: BB0998     GOG: COG1176     Description: putative inner membrane component of binding-protein-dependent transport system Gene: BB0997     GI: 33599985     BI number: BB0997     GOG: COG1177     Description: putative inner membrane component of binding-protein-dependent transport system Gene: BB0996     GI: 33599984     BI number: BB0996     GOG: COG3842     Description: probable ABC transporter ATP-binding protein Gene: BB0995     GI: 33599983     BI number: BB0995     GOG: COG2355     Description: putative dipeptidase Gene: BB0994     GI: 33599982     BI number: BB0994     GOG: COG0665     Description: probable FAD dependent oxidoreductase Gene: BB0993     GI: 33599981     BI number: BB0993     GOG: COG0446     Description: conserved hypothetical protein Gene: BB0992     GI: 33599980     BI number: BB0992     GOG: COG0446     Description: probable pyridine nucleotide-disulphide oxidoreductas Ac                  aa G  g                a  t T  c                t  a C  c                a  a A  c       ag       t  t Gc       a  c      a  t Cg       a  c      c  t Gc        cg       g  a T  c       gc       t  t C  |      c  |       cg T  |       cg        cg Gc        gc        gc Cg        gc        cg Cg        cg        cg Gc       |  c       gc C  c      |  c      |  t T  |      c  t       cg Cg        cg        gc Gc        gc        cg                         ttttttttgatttgacgctgcgcggggcgtgaaacaccataggacacaagagcgagcaggccggcgcctggcgatcagccagtgccggaagacgtggtagttgactttcaggtagtacccggcagccggggcgccccttgcgccccccggcacggacgcacactggacaggacaaacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0687 Spermidine/putrescine-binding periplasmic protein ... can be seen here [E] COG1176 ABC-type spermidine/putrescine transport system, permease component I ... can be seen here [E] COG1177 ABC-type spermidine/putrescine transport system, permease component II ... can be seen here [E] COG3842 ABC-type spermidine/putrescine transport systems, ATPase components ... can be seen here [E] COG2355 Zn-dependent dipeptidase, microsomal dipeptidase homolog ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [R] COG0446 Uncharacterized NAD(FAD)-dependent dehydrogenases ... can be seen here [R] COG0446 Uncharacterized NAD(FAD)-dependent dehydrogenases ... can be seen here     ..................................................................................................................