                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=20 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTACTCCGAGCAGCCGGTGCCGTTCTTCCTGTCGCAGCCGCTGTCGCCAGCCTATCGC
GAACGCGCCGCGCAAGGCGGCCTGCGCAACTTCGACATCTTCGATTTTGCGTTGAACG
GGGTGCAGACGCAGGCCGCGGCCGACGCCTGAgagtatcccggcgcgattaatgcccaggccttcctgggcaaggc
attccattttccgtggaatgcctttttctttttaaaaacaacatgttgcgttgatttattttgcgcggagtcatcgcacggtaacactgaaaaattatta
tttttcgcATG

    BB1009 --- BB1008 --- BB1007 --- BB1006 --- BB1005 Gene: BB1009     GI: 33599997     BI number: BB1009     GOG: COG1524     Description: hypothetical protein Gene: BB1008     GI: 33599996     BI number: BB1008     GOG: COG0747     Description: substrate binding component of ABC transporter Gene: BB1007     GI: 33599995     BI number: BB1007     GOG: COG1173     Description: inner membrane component of ABC transporter Gene: BB1006     GI: 33599994     BI number: BB1006     GOG: COG0601     Description: inner membrane component of ABC transporter Gene: BB1005     GI: 33599993     BI number: BB1005     GOG: COG4172     Description: probable ATP-binding component of ABC transporte   g a  t g  a At Gc |  c T  c Cg Cg Gc Cg A  |                  t Gc                 t  c Cg                 t  c |  a                 tg |  t                 at |  t                 cg |  a                 cg |  a                 ta |  t                 ta Cg        ct        at Gc       c  t       cg Gc        gc        gc C  c       gc        gc G  a       at        at Cg        cg        at Cg        cg       c  t Gc        cg        gt Gc        gc        gt At        ta        gc                         tttttaaaaacaacatgttgcgttgatttattttgcgcggagtcatcgcacggtaacactgaaaaattattatttttcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1524 Uncharacterized proteins of the AP superfamily ... can be seen here [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [R] COG4172 ABC-type uncharacterized transport system, duplicated ATPase component ... can be seen here     ..................................................................................................................