                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=3 nt.   Size=13 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-24.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGGTCGGACGCATCCCGACCTCCTACGGACACCACCAGCTGGTGCTCGACGCGGT
GCTCGCCAACCAGCCCGCCCAGGCGGCCAAGGCCATGTTCGAACACATGAGCCCGGGG
CACGGCACGCGCGGGGTGGCCGACATGATCGTCAACATGCCGCGCTCGCTGCTCAGCT
GAggccgcgcggcgggcaggcgcagggcgccacatttgttactccctggcggcggccggcggtgccacactgtttcggggccgcgcgcatgcggcgcgc
ggcctggcccgaaccaggagacgcatcATG

    BB1057 Gene: BB1057     GI: 33600043     BI number: BB1057     GOG: COG4312     Description: conserved hypothetical protei GA T  g Cg Gc A  c C  g T  c Cg Gc Tg Cg Gc Cg Tg Cg Gc         g C  a      a  g G  |       cg Cg        gc Cg        cg Gc        gc Tg        gc             acatttgttactccctggcggcggccggcggtgccacactgtttcggggccgcgcgcatgcggcgcgcggcctggcccgaaccaggagacgcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4312 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................