                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-26.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-24.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-23.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtcagcaggtgcctgtccgcgtagggacaggcacaccggaagtcggcaggtgcctgtcctcgtggggacaggcaccccgggagtcagcaggtgcctgtcc
gcgtagggacaggcacaccggaagtcagcaggtgcctgtccgcgtagggacaggcacaccggaagtcagctggtgcctgtccgcgcggggacaggcacca
gatttattcctgttcagacttattccatgaaatttactcgcttgttgtgatcaaacccagcgcttagcataggtccctgaacccacagcaggagccccgc
ATG

    BB1089 --- BB1090 --- BB1091 Gene: BB1089     GI: 33600075     BI number: BB1089     GOG: COG1024     Description: putative enoyl-CoA hydratase/isomerase Gene: BB1090     GI: 33600076     BI number: BB1090     GOG: COG1804     Description: conserved hypothetical protein Gene: BB1091     GI: 33600077     BI number: BB1091     GOG: COG0583     Description: LysR-FAMILY transcriptional regulato gt c  a g  g        t cg       g  c cg       a  a ta       a  g gc        gc ta        gt cg        cg cg        cg gc        at ta       c  |       gc gc       a  |      c  g g  a       cg       g  g a  |       gc        cg c  |       gc        cg g  |       at        ta a  |       cg        gc c  |       at        ta t  |       gc        cg g  |       gc        cg a  |      g  |       gc a  |      a  |       ta gc        tg        gc gc        gc        gc cg        cg        ta cg        gc        cg                         atttattcctgttcagacttattccatgaaatttactcgcttgttgtgatcaaacccagcgcttagcataggtccctgaacccacagcaggagccccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................