                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-26.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-27.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAGCCTGTCGGAACAGGACGTCAAGTCGTACGTCCTGGCCAATGCGCCGGCCTACC
AGCATCCGCGCCGCGTGTTCTTCGTCGAGTCGCTGCCGCTGGCGGCCACCAGCAAGGT
GGACCGGCGCGCCCTGGCGCTGCGCGCCCAGGCCGAGGCGTAGcgccagaaggccgtgccgatcggca
atgggctgctccatgagcagcccattccaattccgggctcggacacgcccgagaaggcacttattttccacgcgccggcgcgtagcatggatccatcgga
tcaataaggtggagacATG

    BB1170 Gene: BB1170     GI: 33600156     BI number: BB1170     GOG: COG5553     Description: hypothetical protei ag c  a c  a        a g  g      c  t cg        cg Gc        ta A  c       cg T  g       gc Gt        ta Cg        cg Gc        gc Gc        gc |  g       gc        ga |  a       ta       g  c At        at       c  a Gc        at       t  c Cg       c  |       cg Cg        gc        gc Gc        gc        gc |  a      c  a       gc G  a       ta        cg At        at       |  a Cg        gt        cg Cg       |  c       ta Cg       |  c       ta Gc       |  g      a  | |  t       cg       a  | Cg        cg        cg Gc        gc        cg                         cacttattttccacgcgccggcgcgtagcatggatccatcggatcaataaggtggagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5553 Predicted metal-dependent enzyme of the double-stranded beta helix superfamily ... can be seen here     ..................................................................................................................